Our synthesis technology is not reliant on PCR
Many difficult gene synthesis methods
Codon optimization service for free
Competitive price
2-4 μg high purity plasmid (the default vector pUC57), piercing bacteria, sequencing report, COA report, sqd files
{CAC}82

{GGGTTA}42

{GGTCCTCCGCCTCCTCCACCTC}6

{GCTTCCCCCTG}10

RNA interference (RNAi) refers to the phenomenon that the evolution is high conserved, double-stranded RNA induces homologous mRNA specificity degradation. Cusabio provides you with efficient, fast shRNA vector construction service, and constructs the target sequence into the expression vector in the form of hairpin. It can transcribe continuously & efficiently and process to produce effector molecules, finally ensuring the interference efficiency on the great degree.
Characteristics: After expression, the target protein was purified by nickel column affinity chromatography. The purity reached 90%, and the yield reached 20 mg/L
Your satisfaction is our final goal !
In addition, we also provide you with a variety of value cloning and expression vector construction services.
| vector construction services | ||||
| ShRNA vector | cloning vector | expression vector | microRNA overexpression vector | reporter genevector |
We generally use PCR technology to do directional or random mutations for mutation sites on the basis of guaranteeing fidelity in original sequence, types including bases addition, deletion, mutations etc. It is the common research means of genetic evolution, protein engineering, enzyme engineering etc.
Specialized CRO Services