Gene Synthesis Services

One-stop service of gene, cloning, point mutations :

Our synthesis technology is not reliant on PCR
Many difficult gene synthesis methods
Codon optimization service for free
Competitive price

Fast:

fastest five working days delivery for simple gene under 1Kb

Stable:

complete project management, stable production process

Accurate:

sequence is 100% correct; NanoDrop 2000c accurate determination of concentration and purity

Resolute:

difficult gene, synthesis advantage


Final delivery :

2-4 μg high purity plasmid (the default vector pUC57), piercing bacteria, sequencing report, COA report, sqd files


Case :

{CAC}82

Gene Synthesis case {CAC}82

{GGGTTA}42

Gene Synthesis case {GGGTTA}42

{GGTCCTCCGCCTCCTCCACCTC}6

Gene Synthesis case {GGTCCTCCGCCTCCTCCACCTC}6

{GCTTCCCCCTG}10

Gene Synthesis case {GCTTCCCCCTG}10

Vector Construction Services:

ShRNA vector construction

RNA interference (RNAi) refers to the phenomenon that the evolution is high conserved, double-stranded RNA induces homologous mRNA specificity degradation. Cusabio provides you with efficient, fast shRNA vector construction service, and constructs the target sequence into the expression vector in the form of hairpin. It can transcribe continuously & efficiently and process to produce effector molecules, finally ensuring the interference efficiency on the great degree.

Advantages

Characteristics: After expression, the target protein was purified by nickel column affinity chromatography. The purity reached 90%, and the yield reached 20 mg/L

  • ShRNA vector construction, 100% pass the hairpin area, failed construction does not charge any fees;
  • For anthropogenic gene, Cusabio designs the target spot and ensures more than 70% interference efficiency;
  • DIY construction, we can design and countrcut the vector according to your special demand.

Your satisfaction is our final goal !

In addition, we also provide you with a variety of value cloning and expression vector construction services.

vector construction services
ShRNA vector cloning vector expression vector microRNA overexpression vector reporter genevector

Point Mutation Services :

We generally use PCR technology to do directional or random mutations for mutation sites on the basis of guaranteeing fidelity in original sequence, types including bases addition, deletion, mutations etc. It is the common research means of genetic evolution, protein engineering, enzyme engineering etc.

Advantages

  • Absolutely guarantee the fidelity in the area of gene without mutation and vector
  • All mutations within 24 bp for one step and we only charge the fees of one site
  • Normative, strict standards of quality controlling
icon of phone
Call us
301-363-4651 (Available 9 a.m. to 5 p.m. CST from Monday to Friday)
icon of address
Address
No. 269, Shendun 5th Road, Donghu Hi-Tech Development Area, Hubei Province, 430206, P.R.China
icon of social media
Join us with

Subscribe newsletter

Leave a message

* To protect against spam, please pass the CAPTCHA test below.
CAPTCHA verification
© 2007-2025 CUSABIO TECHNOLOGY LLC All rights reserved. 鄂ICP备15011166号-1